Check out It’s Okay To Be Smart’s video for more about the origins of life on earth:
And check out PBS Space Time’s video on the physics of life:
Viewers like you help make PBS (Thank you 😃) . Support your local PBS Member Station here:
The search for our origins go back to a single common ancestor — one that remains shrouded in mystery. It’s the ancestor of everything we know and today scientists call it the last universal common ancestor, or LUCA.
Produced in collaboration with PBS Digital Studios:
Want to follow Eons elsewhere on the internet?
Facebook –
Twitter –
Instagram –
References:
Nguồn: https://unknownsiberia.com/
Xem thêm bài viết khác: https://unknownsiberia.com/tong-hop/
Xem thêm Bài Viết:
- 5 mẹo phong thủy cực hay giúp bạn mua bán nhà Phủ Lý Hà Nam được giá
- Top 4 công trình kiến trúc Pháp ở Việt Nam nhất định phải ghé thăm
- 5 công cụ giúp bạn bán chung cư Nam Từ Liêm nhanh hơn có từ MeeyLand
- Cách đặt Tab đơn giản trong Word 2010
- Hát mãi ước mơ 3 |Tập 4 FULL:Thoại Mỹ xót lòng khi thấy 2 cụ bà bệnh tật chịu đói lo cho cháu mồ côi
The first creature must have been RNA, meaning looking for minimum genes is kind of intellectually interesting but not very real.
The non-living mess pulled itself together?
From where/what was the life 'breathed' as Darwin puts it?
This is literally the first time I realized this guy and the It's OK To Be Smart guy were two different people.
Everything is always just randomly happening out of chaos 😂 that's just not smart at all.
Luca lives in a California university dorm room.
I thought it was Juan Ponce Enrile
In time, you will know the tragic extent of my failings. – The Ancestor
Unless life formed a multitude of times.
guys that mean that a couple of vents is the reason your watching this video today. thats pretty unreal
What's the meaning of life?
LUCA here… 👀😆
Sorry I had to.
interesting that we first evolved in underwater volcanoes
Have they searched for LUCA on the 7th floor?
Luca must have been the father of Corona
hi
I've a small educational channel and
it would be greatly appreciated
if you be a apart of my small lovely audience
❤️
Hank: "We couldn't even guess at it until we mastered the science of genomics."
*Me, picturing scientists studying gnomes*: "wild"
were there other forms of life that shared LUCA's world but nothing today is related to
so progenotes wear early forms of viruses??
These channels could be used in your science classes
I prefer listening to the other guy. His voice was soothing, This guy's voice is sharp and too aggressive
Yep. Again. My motorcycle number plate: RNA16. Does the number have any meaning?
5:13 We are Fungi childs, respect the mushroom, is a friend.
My brain hurts!
you are awesome. may I use your videos to translate them in Farsi ad show them to people in another platform like Instagram?
The CEO of ancestor
Just curious, what happens to Neanderthals & Devonians? What family would they belong to if they were close enough to breed with & produce viable offspring who could in turn also reproduce? I ask as their genetic material is found in a certain percentage of modern humans.
Oh yeah, I remember this from the last episode of Star Trek: The Next Generation!
OMG!!!_ It's a Sicilian message…. LUCA sleeps with the fishes!!
…why does it seems that every science commentator on YouTube has just fallen off the "Big Bang Theory" truck?
2:07 "DNA Sequence …GATCGCATGCATGCTAGCTAGCTAGCTAGCTAGAGCTTCG….."
Looks like somebody's cat was sleeping on the keyboard
OT question:
is there any truth behind "aquatic ape hypothesis"?
Interesting video. Why is the most common hypothesis that there is only one ancestor? And why do we talk about the origin of life rather than origins? Could there not have been several occasions over the course of history in which life originated? Why would it only originate once given that the right conditions for life have continued to exist over billions of years?
Yes, you and your friends do a great job of explaining things everyone should know. I will tell my friends.
As we have had not one or two but six or seven mass extinctions, how can we be sure the genome sequences surviving till today are from luca?
So is it possible that LUCA might be still out there somewhere today?
Could progenotes be primitive viruses?
If you want to find Luca………try the second floor.
I still don't get it why organisms with more jeans are considered more evolved
Biologically speaking why does it have to be a single ancestor? Couldn't two organisms have evolved independently but along side each other?
Atoms did not form on Earth. They were synthesized in the stars interiors. Then they went to interstellar medium of dust and clouds courtesy of supernovae. Then gravity collapsed them into solar systems via accretion disks.
So life came from hell. Got it.
Sounds familiar
Should it not , instead of Luca be the "first common ancestor" … FUCA…?
The minimum gene theory. Could virus' have been the other side of Luca. Instead of just a low number of genes.
Mad Magazine is where it all started.
Shout out to Carl Woese and UIUC !
This was so good!
So I am the first thing …
Bow to me, my children.
(Btw, PBS Eons is freaking awesome. Best sub I have ever made)
Luca? Lives on the second floor I understand?
Hey,I would like to see a video on E8.
Video idea: if neanderthals and homosapiens hadn't cross bred would we be smarter?